am1 1845 Search Results


94
ATCC am1 1845
Am1 1845, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/am1 1845/product/ATCC
Average 94 stars, based on 1 article reviews
am1 1845 - by Bioz Stars, 2026-03
94/100 stars
  Buy from Supplier


N/A
strong MicroRNA hsa miR 3616 3p strong Accession Number MIMAT0017996 Mature Sequence CGAGGGCAUUUCAUGAUGCAGGC hsa miR 3616 3p are small non coding RNAs of 20 22 nucleotides typically excised from 60 110 nucleotide foldback RNA precursor
  Buy from Supplier

N/A
qSTAR qPCR primer pairs against Homo sapiens gene FAM153A
  Buy from Supplier

Image Search Results